Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 312112
End position: 312171
Length: 60

DNA sequence
>NC_021658, from 312112 to 312171 (60 bp); Sorangium cellulosum So0157-2 CGCGCCGTCTTCCGTCGCGCCCTCCTCCGACGCGTCGCCCTCCGTCGCGCCGTTCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 312092-313048	Sequence	SCE1572_01240 - hypothetical protein (Protein is coded in complementary strand; from 313048 to 312092)