Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3120482
End position: 3120523
Length: 42

DNA sequence
>NC_021658, from 3120482 to 3120523 (42 bp); Sorangium cellulosum So0157-2 CGCCGGCGCTGGCGCCTGCGCCGGAGCCGGCGCTGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3120132-3122390	Sequence	SCE1572_11335 - hypothetical protein (Protein is coded in complementary strand; from 3122390 to 3120132)