Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3084756
End position: 3084779
Length: 24

DNA sequence
>NC_021658, from 3084756 to 3084779 (24 bp); Sorangium cellulosum So0157-2 CCGCCGCGGCCGCCGTCGCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3083862-3084884	Sequence	SCE1572_11195 - GTPase CgtA (Protein is coded in complementary strand; from 3084884 to 3083862)