Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3010098
End position: 3010121
Length: 24

DNA sequence
>NC_021658, from 3010098 to 3010121 (24 bp); Sorangium cellulosum So0157-2 CGCGCGCTCGCGCACGCGCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3008980-3012585	Sequence	SCE1572_10885 - hypothetical protein (Protein is coded in complementary strand; from 3012585 to 3008980)