Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3008819
End position: 3008843
Length: 25

DNA sequence
>NC_021658, from 3008819 to 3008843 (25 bp); Sorangium cellulosum So0157-2 CGCGCCTCGCCGCGCAGCGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3008420-3008983	Sequence	SCE1572_10880 - hypothetical protein (Protein is coded in complementary strand; from 3008983 to 3008420)