Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2993725
End position: 2993754
Length: 30

DNA sequence
>NC_021658, from 2993725 to 2993754 (30 bp); Sorangium cellulosum So0157-2 GCGCGCCGGCGCTCGCCGCCGGGCGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2993707-2994480	Sequence	SCE1572_10835 - hypothetical protein (Protein is coded in complementary strand; from 2994480 to 2993707)