Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2953198
End position: 2953221
Length: 24

DNA sequence
>NC_021658, from 2953198 to 2953221 (24 bp); Sorangium cellulosum So0157-2 GAGGGCGACGGCGAGCGCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2953193-2953999	Sequence	SCE1572_10660 - hypothetical protein (Protein is coded in complementary strand; from 2953999 to 2953193)