Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2948350
End position: 2948373
Length: 24

DNA sequence
>NC_021658, from 2948350 to 2948373 (24 bp); Sorangium cellulosum So0157-2 CGCCGACGCCGCCGGCGACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2947080-2948570	Sequence	SCE1572_10635 - Fis family transcriptional regulator (Protein is coded in complementary strand; from 2948570 to 2947080)