Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2925068
End position: 2925091
Length: 24

DNA sequence
>NC_021658, from 2925068 to 2925091 (24 bp); Sorangium cellulosum So0157-2 CGAGCGCGACCGCGAGGGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2924764-2925930	Sequence	SCE1572_10545 - hypothetical protein (Protein is coded in complementary strand; from 2925930 to 2924764)