Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2888581
End position: 2888607
Length: 27

DNA sequence
>NC_021658, from 2888581 to 2888607 (27 bp); Sorangium cellulosum So0157-2 CCGCTCCAGCCGCTCCAGCCGCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2886554-2888638	Sequence	SCE1572_10390 - hypothetical protein (Protein is coded in complementary strand; from 2888638 to 2886554)