Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2835765
End position: 2835788
Length: 24

DNA sequence
>NC_021658, from 2835765 to 2835788 (24 bp); Sorangium cellulosum So0157-2 CGGCGCTGGCGCCGGCTCCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2835358-2836290	Sequence	SCE1572_10230 - hypothetical protein (Protein is coded in complementary strand; from 2836290 to 2835358)