Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2831220
End position: 2831243
Length: 24

DNA sequence
>NC_021658, from 2831220 to 2831243 (24 bp); Sorangium cellulosum So0157-2 GCCGCCGTCGCCGCCGCTGCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2830915-2831316	Sequence	SCE1572_10215 - hypothetical protein (Protein is coded in complementary strand; from 2831316 to 2830915)