Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2685916
End position: 2685960
Length: 45

DNA sequence
>NC_021658, from 2685916 to 2685960 (45 bp); Sorangium cellulosum So0157-2 CTGCTGGCGCTGCTGCTGCTGGCGCTGCTGCTGCTGGCGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2683987-2686290	Sequence	SCE1572_09725 - hypothetical protein (Protein is coded in complementary strand; from 2686290 to 2683987)