Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2528838
End position: 2528861
Length: 24

DNA sequence
>NC_021658, from 2528838 to 2528861 (24 bp); Sorangium cellulosum So0157-2 TTCATGTTCATCTCCATGTTCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2527689-2528861	Sequence	SCE1572_09095 - hypothetical protein (Protein is coded in complementary strand; from 2528861 to 2527689)