Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2526896
End position: 2526943
Length: 48

DNA sequence
>NC_021658, from 2526896 to 2526943 (48 bp); Sorangium cellulosum So0157-2 CCGCCGCTGCCGCCGCTGCCGCCGGCGCCGCCGGCGCCGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2524115-2527048	Sequence	SCE1572_09085 - hypothetical protein (Protein is coded in complementary strand; from 2527048 to 2524115)