Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2523712
End position: 2523765
Length: 54

DNA sequence
>NC_021658, from 2523712 to 2523765 (54 bp); Sorangium cellulosum So0157-2 CGCCGCCCGTGCCGCCGGCGCCGCCCGTGCCGCCCGTGCCGCCCGCGCCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2522223-2523794	Sequence	SCE1572_09080 - hypothetical protein (Protein is coded in complementary strand; from 2523794 to 2522223)