Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2510052
End position: 2510105
Length: 54

DNA sequence
>NC_021658, from 2510052 to 2510105 (54 bp); Sorangium cellulosum So0157-2 GCGCGGCCGTCGCGGGCTGCGCGGCCGTCGCGGGCTTGGCCGCCGTCGCGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2508437-2510308	Sequence	SCE1572_09040 - hypothetical protein (Protein is coded in complementary strand; from 2510308 to 2508437)