Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2465614
End position: 2465637
Length: 24

DNA sequence
>NC_021658, from 2465614 to 2465637 (24 bp); Sorangium cellulosum So0157-2 GCCTCGGCCCCGGGCTCGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2464630-2468574	Sequence	SCE1572_08875 - hypothetical protein (Protein is coded in complementary strand; from 2468574 to 2464630)