Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2380118
End position: 2380150
Length: 33

DNA sequence
>NC_021658, from 2380118 to 2380150 (33 bp); Sorangium cellulosum So0157-2 TCACCAGCGCGTCACCGGCGCGTCACCAGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2380150-2381091	Sequence	SCE1572_08560 - hypothetical protein (Protein is coded in complementary strand; from 2381091 to 2380150)