Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2366096
End position: 2366119
Length: 24

DNA sequence
>NC_021658, from 2366096 to 2366119 (24 bp); Sorangium cellulosum So0157-2 TCAGCCCATCAGCCCATCGGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2366097-2368049	Sequence	SCE1572_08510 - hypothetical protein (Protein is coded in complementary strand; from 2368049 to 2366097)