Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2333391
End position: 2333426
Length: 36

DNA sequence
>NC_021658, from 2333391 to 2333426 (36 bp); Sorangium cellulosum So0157-2 CCGGTGCCGCCGGTGCCGCCGGTGCCGCCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2332647-2333501	Sequence	SCE1572_08375 - hypothetical protein (Protein is coded in complementary strand; from 2333501 to 2332647)