Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 221794
End position: 221841
Length: 48

DNA sequence
>NC_021658, from 221794 to 221841 (48 bp); Sorangium cellulosum So0157-2 CGGCCTCCTCGTCGGCCTCCTCGTCGGCCTCCTCGTCGGCCTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 220371-222329	Sequence	SCE1572_00785 - hypothetical protein (Protein is coded in complementary strand; from 222329 to 220371)