Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2134968
End position: 2134995
Length: 28

DNA sequence
>NC_021658, from 2134968 to 2134995 (28 bp); Sorangium cellulosum So0157-2 GCGAGGTGCGAGGTGCGAGGTGCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2134908-2135192	Sequence	SCE1572_07565 - hypothetical protein (Protein is coded in complementary strand; from 2135192 to 2134908)