Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2124655
End position: 2124681
Length: 27

DNA sequence
>NC_021658, from 2124655 to 2124681 (27 bp); Sorangium cellulosum So0157-2 CGTCGGTTCCGTCAGTTCCGTCAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2124676-2127096	Sequence	SCE1572_07530 - hypothetical protein (Protein is coded in complementary strand; from 2127096 to 2124676)