Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2124167
End position: 2124190
Length: 24

DNA sequence
>NC_021658, from 2124167 to 2124190 (24 bp); Sorangium cellulosum So0157-2 TCGCCGCCGCCGTCGTCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2123621-2124631	Sequence	SCE1572_07525 - hypothetical protein (Protein is coded in complementary strand; from 2124631 to 2123621)