Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2101108
End position: 2101170
Length: 63

DNA sequence
>NC_021658, from 2101108 to 2101170 (63 bp); Sorangium cellulosum So0157-2 GGGAGAGGGCTGCGTGTCGTCGGGGGCCGGCTGCGTGTCGTCGGGTTCCGGCTGCGTGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2100566-2101285	Sequence	SCE1572_07435 - hypothetical protein (Protein is coded in complementary strand; from 2101285 to 2100566)