Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2077481
End position: 2077516
Length: 36

DNA sequence
>NC_021658, from 2077481 to 2077516 (36 bp); Sorangium cellulosum So0157-2 CCTTCTGCGCCGCCCTCTGCGGCGCCTGCTGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2077472-2079103	Sequence	SCE1572_07340 - hypothetical protein (Protein is coded in complementary strand; from 2079103 to 2077472)