Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 203935
End position: 203994
Length: 60

DNA sequence
>NC_021658, from 203935 to 203994 (60 bp); Sorangium cellulosum So0157-2 CCTGAACGCGCTGAGCCTGAACGCGCTGAGCCTGAACGCGCTGAGCCTGAACGCGCTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 203882-204019	Sequence	SCE1572_00735 - hypothetical protein (Protein is coded in complementary strand; from 204019 to 203882)