Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1997950
End position: 1997976
Length: 27

DNA sequence
>NC_021658, from 1997950 to 1997976 (27 bp); Sorangium cellulosum So0157-2 CGCCGCTCGCGCTGCTCGCGCCGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1997940-1998995	Sequence	SCE1572_07000 - hypothetical protein (Protein is coded in complementary strand; from 1998995 to 1997940)