Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1995643
End position: 1995698
Length: 56

DNA sequence
>NC_021658, from 1995643 to 1995698 (56 bp); Sorangium cellulosum So0157-2 CGCGCGCTCAGTTCGGCGCGCTCAGCTCGGCGCGCTCAGCTCGGCGCGCTCAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1994258-1995643	Sequence	SCE1572_06990 - hypothetical protein
ORF... 1995693-1996142	Sequence	SCE1572_06995 - aspartate decarboxylase (Protein is coded in complementary strand; from 1996142 to 1995693)