Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1874884
End position: 1874928
Length: 45

DNA sequence
>NC_021658, from 1874884 to 1874928 (45 bp); Sorangium cellulosum So0157-2 CGTGTCGCCGCCGCCGGCATCGCCGCCGCCGGTCTCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1873583-1875013	Sequence	SCE1572_06560 - hypothetical protein (Protein is coded in complementary strand; from 1875013 to 1873583)