Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 182779
End position: 182805
Length: 27

DNA sequence
>NC_021658, from 182779 to 182805 (27 bp); Sorangium cellulosum So0157-2 CGAGCAGGCCGTGCAGGCCGAGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 182286-182915	Sequence	SCE1572_00645 - hypothetical protein (Protein is coded in complementary strand; from 182915 to 182286)