Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1800126
End position: 1800188
Length: 63

DNA sequence
>NC_021658, from 1800126 to 1800188 (63 bp); Sorangium cellulosum So0157-2 GCCCGCGCCGCCGGTGCCGCCGCCGGCGCCGCCGGTGCCGACGCTCGTGCCGCCGGTGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1799299-1800381	Sequence	SCE1572_06285 - hypothetical protein (Protein is coded in complementary strand; from 1800381 to 1799299)