Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1726250
End position: 1726294
Length: 45

DNA sequence
>NC_021658, from 1726250 to 1726294 (45 bp); Sorangium cellulosum So0157-2 GGAGCGGTCGCCACGAGAGCGGTCGCCACGGGAGCGGTCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1726004-1726501	Sequence	SCE1572_06055 - hypothetical protein (Protein is coded in complementary strand; from 1726501 to 1726004)