Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1690894
End position: 1690938
Length: 45

DNA sequence
>NC_021658, from 1690894 to 1690938 (45 bp); Sorangium cellulosum So0157-2 GGGCACGTAGCCGGGCGGCGGGTAGCCGGGCGGCGGGTAGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1690466-1690900	Sequence	SCE1572_05900 - hypothetical protein (Protein is coded in complementary strand; from 1690900 to 1690466)