Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1687235
End position: 1687259
Length: 25

DNA sequence
>NC_021658, from 1687235 to 1687259 (25 bp); Sorangium cellulosum So0157-2 GCGCGGCGGGGCGCCGCTCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1687012-1687902	Sequence	SCE1572_05890 - pantoate--beta-alanine ligase (Protein is coded in complementary strand; from 1687902 to 1687012)