Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1673452
End position: 1673475
Length: 24

DNA sequence
>NC_021658, from 1673452 to 1673475 (24 bp); Sorangium cellulosum So0157-2 GCCGCCGGCGCCTCCGCCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1672537-1673601	Sequence	SCE1572_05830 - hypothetical protein (Protein is coded in complementary strand; from 1673601 to 1672537)