Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1612515
End position: 1612562
Length: 48

DNA sequence
>NC_021658, from 1612515 to 1612562 (48 bp); Sorangium cellulosum So0157-2 CGGGCGCAGCGGCGGGCGCAGGCGCAGGCGCGGCGGCGGGCGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1611170-1612648	Sequence	SCE1572_05660 - hypothetical protein (Protein is coded in complementary strand; from 1612648 to 1611170)