Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1610389
End position: 1610412
Length: 24

DNA sequence
>NC_021658, from 1610389 to 1610412 (24 bp); Sorangium cellulosum So0157-2 CGCCACCGTCACCGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1610343-1610672	Sequence	SCE1572_05650 - hypothetical protein (Protein is coded in complementary strand; from 1610672 to 1610343)