Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1589553
End position: 1589579
Length: 27

DNA sequence
>NC_021658, from 1589553 to 1589579 (27 bp); Sorangium cellulosum So0157-2 CCCGTCGCGCCCGTCGCGCCCGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1587964-1589730	Sequence	SCE1572_05595 - hypothetical protein (Protein is coded in complementary strand; from 1589730 to 1587964)