Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1568759
End position: 1568812
Length: 54

DNA sequence
>NC_021658, from 1568759 to 1568812 (54 bp); Sorangium cellulosum So0157-2 AGCGGCCGGCGCCGGGGCAGCGGCCGGCGCCGAGGCAGCGGCCGGCGCCGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1567581-1568891	Sequence	SCE1572_05555 - hypothetical protein (Protein is coded in complementary strand; from 1568891 to 1567581)