Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1561892
End position: 1561918
Length: 27

DNA sequence
>NC_021658, from 1561892 to 1561918 (27 bp); Sorangium cellulosum So0157-2 ACGCGAACCACGCGAACGCCGCGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1560046-1562346	Sequence	SCE1572_05525 - hypothetical protein (Protein is coded in complementary strand; from 1562346 to 1560046)