Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1555425
End position: 1555460
Length: 36

DNA sequence
>NC_021658, from 1555425 to 1555460 (36 bp); Sorangium cellulosum So0157-2 CGGCGGGCTCGGCGGCGGGCTCGACGGCGATCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1555066-1555425	Sequence	SCE1572_05490 - hypothetical protein (Protein is coded in complementary strand; from 1555425 to 1555066)