Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1548125
End position: 1548154
Length: 30

DNA sequence
>NC_021658, from 1548125 to 1548154 (30 bp); Sorangium cellulosum So0157-2 CGCGCCGCGCCGCCGCGCGCCGCAGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1548100-1549218	Sequence	SCE1572_05460 - hypothetical protein (Protein is coded in complementary strand; from 1549218 to 1548100)