Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 143537
End position: 143566
Length: 30

DNA sequence
>NC_021658, from 143537 to 143566 (30 bp); Sorangium cellulosum So0157-2 GGCGCCGGCGCTGCCGCCGCCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 142851-143735	Sequence	SCE1572_00485 - hypothetical protein (Protein is coded in complementary strand; from 143735 to 142851)