Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1387788
End position: 1387811
Length: 24

DNA sequence
>NC_021658, from 1387788 to 1387811 (24 bp); Sorangium cellulosum So0157-2 CCTCGTCTTCGTCTTCGTCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1387784-1389619	Sequence	SCE1572_04885 - hypothetical protein (Protein is coded in complementary strand; from 1389619 to 1387784)