Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 135578
End position: 135631
Length: 54

DNA sequence
>NC_021658, from 135578 to 135631 (54 bp); Sorangium cellulosum So0157-2 CCGCCACGCCCGCGCCCGCCGCCACGCCCGCGCCCGCCGCCACGGCCGCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 134881-138618	Sequence	SCE1572_00460 - hypothetical protein (Protein is coded in complementary strand; from 138618 to 134881)