Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1339586
End position: 1339630
Length: 45

DNA sequence
>NC_021658, from 1339586 to 1339630 (45 bp); Sorangium cellulosum So0157-2 GCCTGGGCGACCGCCGCCTGGGCGACCGCCGCCTGGGAGACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1339451-1339858	Sequence	SCE1572_04700 - hypothetical protein (Protein is coded in complementary strand; from 1339858 to 1339451)