Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 123521
End position: 123544
Length: 24

DNA sequence
>NC_021658, from 123521 to 123544 (24 bp); Sorangium cellulosum So0157-2 CGCCGTCGCCGATGCCGTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 120922-125175	Sequence	SCE1572_00410 - hypothetical protein (Protein is coded in complementary strand; from 125175 to 120922)