Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1213655
End position: 1213714
Length: 60

DNA sequence
>NC_021658, from 1213655 to 1213714 (60 bp); Sorangium cellulosum So0157-2 CGCGCGCGGCCTGGATCAGCCGCGCGCCGCCTGGATCAGCCGCGCGCCGCCTGGATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1213691-1214662	Sequence	SCE1572_04250 - hypothetical protein (Protein is coded in complementary strand; from 1214662 to 1213691)